ID: 1085171814_1085171817

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1085171814 1085171817
Species Human (GRCh38) Human (GRCh38)
Location 11:74456122-74456144 11:74456168-74456190
Sequence CCTGGGCAACATGTGAAACCCTG ATATATATATATAAATTAACTGG
Strand - +
Off-target summary {0: 12, 1: 131, 2: 393, 3: 1208, 4: 4211} {0: 2, 1: 68, 2: 219, 3: 1203, 4: 5403}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!