|
Left Crispr |
Right Crispr |
Crispr ID |
1085171816 |
1085171817 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
11:74456141-74456163
|
11:74456168-74456190
|
Sequence |
CCTGTCTCTACTTAAATATATAT |
ATATATATATATAAATTAACTGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 16, 2: 135, 3: 1461, 4: 18583} |
{0: 2, 1: 68, 2: 219, 3: 1203, 4: 5403} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|