ID: 1085859646_1085859653

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1085859646 1085859653
Species Human (GRCh38) Human (GRCh38)
Location 11:80216741-80216763 11:80216791-80216813
Sequence CCCTCAGAAATGAAGGAGAAATA GAAATTCATCACCACTGGACTGG
Strand - +
Off-target summary {0: 39, 1: 229, 2: 839, 3: 1388, 4: 2020} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!