ID: 1085916277_1085916279

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1085916277 1085916279
Species Human (GRCh38) Human (GRCh38)
Location 11:80891894-80891916 11:80891910-80891932
Sequence CCTATTAAAGGGAATTCTGTCTG CTGTCTGTGCTTGGTAAACAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!