ID: 1086063181_1086063188

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1086063181 1086063188
Species Human (GRCh38) Human (GRCh38)
Location 11:82721036-82721058 11:82721073-82721095
Sequence CCAGTACCTTTTAAATCCTGAGA CACCCAGAGCTCTTCCTCATTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 13, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!