ID: 1086119021_1086119032

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1086119021 1086119032
Species Human (GRCh38) Human (GRCh38)
Location 11:83286297-83286319 11:83286328-83286350
Sequence CCAACAGCTGGCTCCCCCAAGAT GCCATTACGCGCTTGGGTCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 155} {0: 1, 1: 0, 2: 0, 3: 1, 4: 7}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!