ID: 1086399533_1086399535

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1086399533 1086399535
Species Human (GRCh38) Human (GRCh38)
Location 11:86449073-86449095 11:86449087-86449109
Sequence CCCATATGGAACAATAGGAAGCT TAGGAAGCTCAGTTCTGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 111} {0: 1, 1: 0, 2: 3, 3: 24, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!