ID: 1086452649_1086452658

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1086452649 1086452658
Species Human (GRCh38) Human (GRCh38)
Location 11:86932400-86932422 11:86932429-86932451
Sequence CCATCACCATCAGTGACACGGCC CCTCCAGAAGAGTTTGCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 135} {0: 1, 1: 1, 2: 3, 3: 22, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!