ID: 1086819026_1086819036

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1086819026 1086819036
Species Human (GRCh38) Human (GRCh38)
Location 11:91412079-91412101 11:91412106-91412128
Sequence CCCCCTGGGGTTCACGCCATTCC CCTCAGCCCCCGGAGTAGCTTGG
Strand - +
Off-target summary No data {0: 65, 1: 7215, 2: 219117, 3: 281072, 4: 176597}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!