ID: 1086892772_1086892778

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1086892772 1086892778
Species Human (GRCh38) Human (GRCh38)
Location 11:92277629-92277651 11:92277652-92277674
Sequence CCCACTTGTAAGTGGTAGCATTG GGCATACATGGGCGTAAAGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 121, 4: 638}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!