ID: 1086957155_1086957160

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1086957155 1086957160
Species Human (GRCh38) Human (GRCh38)
Location 11:92945191-92945213 11:92945212-92945234
Sequence CCAAGGCCCATGTAAGGCTACAG AGGGAGCCAAATACCTTCTCTGG
Strand - +
Off-target summary No data {0: 3, 1: 6, 2: 5, 3: 19, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!