ID: 1087194075_1087194077

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1087194075 1087194077
Species Human (GRCh38) Human (GRCh38)
Location 11:95287141-95287163 11:95287165-95287187
Sequence CCACTTTTTAAACTTCTTAGAAC TTTAATTTCCTGTTTTGGACTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!