ID: 1087205716_1087205721

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1087205716 1087205721
Species Human (GRCh38) Human (GRCh38)
Location 11:95391859-95391881 11:95391900-95391922
Sequence CCTTAAAGCTGGAGAATAATCTC CAACCTGAGCACACTGATATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 69, 4: 336} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!