ID: 1087291576_1087291583

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1087291576 1087291583
Species Human (GRCh38) Human (GRCh38)
Location 11:96326456-96326478 11:96326499-96326521
Sequence CCCTTCCTTCTTTCTTTTATATC AACTATCTCGAGTTTAGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 24, 3: 484, 4: 3662} {0: 1, 1: 0, 2: 0, 3: 0, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!