ID: 1087389291_1087389294 |
View in Genome Browser |
Spacer: 0 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1087389291 | 1087389294 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 11:97513808-97513830 | 11:97513831-97513853 |
| Sequence | CCATATACTTTTCCACATGTGTT | TGGATTGTACCTCAGTACTGAGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 0, 2: 3, 3: 30, 4: 401} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||