ID: 1087517411_1087517413

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1087517411 1087517413
Species Human (GRCh38) Human (GRCh38)
Location 11:99181396-99181418 11:99181419-99181441
Sequence CCAGGTTGGATTACAAGTGTTAT TATCCCACCCCCATTGGTATTGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 11, 3: 13, 4: 132} {0: 2, 1: 2, 2: 0, 3: 5, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!