ID: 1087851436_1087851440

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1087851436 1087851440
Species Human (GRCh38) Human (GRCh38)
Location 11:103034661-103034683 11:103034708-103034730
Sequence CCAATCTCTACTAAAAATACAGA GTTTGTAGTCCCAGCTACTCTGG
Strand - +
Off-target summary {0: 1239, 1: 91025, 2: 241887, 3: 157057, 4: 80156} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!