ID: 1087956858_1087956862

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1087956858 1087956862
Species Human (GRCh38) Human (GRCh38)
Location 11:104299239-104299261 11:104299273-104299295
Sequence CCTGTGTTCCTTTGCTGAGACTG CTTCATCCATGTCCCTGCAAAGG
Strand - +
Off-target summary No data {0: 5722, 1: 13953, 2: 17651, 3: 7003, 4: 4429}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!