ID: 1087956858_1087956863

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1087956858 1087956863
Species Human (GRCh38) Human (GRCh38)
Location 11:104299239-104299261 11:104299274-104299296
Sequence CCTGTGTTCCTTTGCTGAGACTG TTCATCCATGTCCCTGCAAAGGG
Strand - +
Off-target summary No data {0: 139, 1: 247, 2: 256, 3: 535, 4: 1011}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!