ID: 1087956858_1087956863 |
View in Genome Browser |
Spacer: 12 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1087956858 | 1087956863 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 11:104299239-104299261 | 11:104299274-104299296 |
Sequence | CCTGTGTTCCTTTGCTGAGACTG | TTCATCCATGTCCCTGCAAAGGG |
Strand | - | + |
Off-target summary | No data | {0: 139, 1: 247, 2: 256, 3: 535, 4: 1011} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |