ID: 1088080531_1088080539

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1088080531 1088080539
Species Human (GRCh38) Human (GRCh38)
Location 11:105906601-105906623 11:105906650-105906672
Sequence CCATCTCTAGATTTCCATCTTCT CCAGCTAATACGTGGTAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 434} {0: 1, 1: 0, 2: 1, 3: 3, 4: 45}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!