ID: 1088130566_1088130574

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1088130566 1088130574
Species Human (GRCh38) Human (GRCh38)
Location 11:106484176-106484198 11:106484196-106484218
Sequence CCATACCTCACAGCTCCTGAACT ACTTTATGGGTTTGGGTGCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!