ID: 1088246182_1088246192

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1088246182 1088246192
Species Human (GRCh38) Human (GRCh38)
Location 11:107820349-107820371 11:107820396-107820418
Sequence CCTCTCTTCCCTGGAAGTCTCAG CACTTTAATCAAGGAGACTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 343} {0: 1, 1: 0, 2: 4, 3: 171, 4: 3602}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!