ID: 1088246184_1088246192

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1088246184 1088246192
Species Human (GRCh38) Human (GRCh38)
Location 11:107820358-107820380 11:107820396-107820418
Sequence CCTGGAAGTCTCAGAATTGCAGA CACTTTAATCAAGGAGACTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 255} {0: 1, 1: 0, 2: 4, 3: 171, 4: 3602}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!