ID: 1088283254_1088283257

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1088283254 1088283257
Species Human (GRCh38) Human (GRCh38)
Location 11:108159493-108159515 11:108159526-108159548
Sequence CCATGATCACAGGACCAATAAGC GGATTCAAACCCAGACTTGTAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 6, 4: 112} {0: 1, 1: 1, 2: 11, 3: 61, 4: 359}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!