ID: 1088330178_1088330182

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1088330178 1088330182
Species Human (GRCh38) Human (GRCh38)
Location 11:108643151-108643173 11:108643198-108643220
Sequence CCTCGCCTCTTCTGAAAATACAA CGCCTGTGGTCCCAGCTACTTGG
Strand - +
Off-target summary No data {0: 1698, 1: 50471, 2: 116116, 3: 175602, 4: 127583}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!