ID: 1088330178_1088330183

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1088330178 1088330183
Species Human (GRCh38) Human (GRCh38)
Location 11:108643151-108643173 11:108643199-108643221
Sequence CCTCGCCTCTTCTGAAAATACAA GCCTGTGGTCCCAGCTACTTGGG
Strand - +
Off-target summary No data {0: 2717, 1: 41335, 2: 169840, 3: 257462, 4: 215499}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!