ID: 1089197865_1089197871

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1089197865 1089197871
Species Human (GRCh38) Human (GRCh38)
Location 11:116705503-116705525 11:116705554-116705576
Sequence CCCAAAGTGCTGGGATTACAGGC CTTAATGTGCAGAAATTGAAAGG
Strand - +
Off-target summary {0: 215700, 1: 270647, 2: 186590, 3: 142154, 4: 223611} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!