ID: 1089197866_1089197871 |
View in Genome Browser |
Spacer: 27 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1089197866 | 1089197871 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 11:116705504-116705526 | 11:116705554-116705576 |
Sequence | CCAAAGTGCTGGGATTACAGGCA | CTTAATGTGCAGAAATTGAAAGG |
Strand | - | + |
Off-target summary | {0: 89533, 1: 228199, 2: 240322, 3: 214910, 4: 187714} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |