ID: 1089288072_1089288080

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1089288072 1089288080
Species Human (GRCh38) Human (GRCh38)
Location 11:117420312-117420334 11:117420355-117420377
Sequence CCTGGCGGGGCTCAGCTGGGGAC TGGTGCCATCCACCTCCACTGGG
Strand - +
Off-target summary No data {0: 1, 1: 5, 2: 2, 3: 14, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!