ID: 1089443726_1089443731

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1089443726 1089443731
Species Human (GRCh38) Human (GRCh38)
Location 11:118535188-118535210 11:118535201-118535223
Sequence CCCACCTCCTCTTGGGAATTCTA GGGAATTCTAGGTTACACGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 182} {0: 1, 1: 0, 2: 0, 3: 4, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!