ID: 1089516508_1089516520

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1089516508 1089516520
Species Human (GRCh38) Human (GRCh38)
Location 11:119035705-119035727 11:119035758-119035780
Sequence CCAGGTGTGGTGGCATGTACCTG CAGGATTGCTTGAGGCAGGAAGG
Strand - +
Off-target summary {0: 125, 1: 3157, 2: 14600, 3: 46047, 4: 100534} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!