ID: 1089516512_1089516517

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1089516512 1089516517
Species Human (GRCh38) Human (GRCh38)
Location 11:119035724-119035746 11:119035739-119035761
Sequence CCTGTGGTCCCAGCTAATTGGGA AATTGGGAGACTGAGGTGGCAGG
Strand - +
Off-target summary {0: 28, 1: 4683, 2: 54889, 3: 172316, 4: 243730} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!