ID: 1089516515_1089516520

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1089516515 1089516520
Species Human (GRCh38) Human (GRCh38)
Location 11:119035733-119035755 11:119035758-119035780
Sequence CCAGCTAATTGGGAGACTGAGGT CAGGATTGCTTGAGGCAGGAAGG
Strand - +
Off-target summary {0: 7, 1: 902, 2: 19412, 3: 128996, 4: 275718} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!