ID: 1089539164_1089539171

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1089539164 1089539171
Species Human (GRCh38) Human (GRCh38)
Location 11:119179699-119179721 11:119179722-119179744
Sequence CCACGAGTGTTTGGGCGCATGGT GGGTAAAAGCCGGGAGGCGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 34} {0: 1, 1: 0, 2: 6, 3: 81, 4: 1750}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!