ID: 1089574997_1089575005

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1089574997 1089575005
Species Human (GRCh38) Human (GRCh38)
Location 11:119435634-119435656 11:119435672-119435694
Sequence CCTGGGGATATTTGGCCATGTCT TGTTGCAATTGGGGTGAGCTGGG
Strand - +
Off-target summary {0: 4, 1: 39, 2: 288, 3: 719, 4: 1360} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!