ID: 1089608088_1089608093

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1089608088 1089608093
Species Human (GRCh38) Human (GRCh38)
Location 11:119653439-119653461 11:119653454-119653476
Sequence CCCGGCGCGGGGATCCCAACCCA CCAACCCAGCCCTGCCCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 90} {0: 1, 1: 0, 2: 6, 3: 65, 4: 453}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!