ID: 1089640595_1089640603

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1089640595 1089640603
Species Human (GRCh38) Human (GRCh38)
Location 11:119844961-119844983 11:119844999-119845021
Sequence CCAAGTTTCCAGCAAGGGCTGAG GAGCAGTCAGGATCGTTGCCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!