ID: 1089773983_1089773993

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1089773983 1089773993
Species Human (GRCh38) Human (GRCh38)
Location 11:120823462-120823484 11:120823514-120823536
Sequence CCCGGTCATTCCAGAGCTGAGAA CAGGTCGCACAGCTGGTACGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 196} {0: 1, 1: 1, 2: 5, 3: 145, 4: 794}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!