|
Left Crispr |
Right Crispr |
| Crispr ID |
1090091741 |
1090091746 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:123704011-123704033
|
11:123704036-123704058
|
| Sequence |
CCAAACTTTTGGCTTCCCTGGGC |
CATTGGAAGAAGAATTGTCTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 24, 1: 747, 2: 980, 3: 645, 4: 513} |
{0: 215, 1: 433, 2: 341, 3: 249, 4: 314} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|