ID: 1090091741_1090091747

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1090091741 1090091747
Species Human (GRCh38) Human (GRCh38)
Location 11:123704011-123704033 11:123704037-123704059
Sequence CCAAACTTTTGGCTTCCCTGGGC ATTGGAAGAAGAATTGTCTTGGG
Strand - +
Off-target summary {0: 24, 1: 747, 2: 980, 3: 645, 4: 513} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!