ID: 1090371224_1090371228

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1090371224 1090371228
Species Human (GRCh38) Human (GRCh38)
Location 11:126254495-126254517 11:126254529-126254551
Sequence CCATAGATCTTAAAGGGGAACAT TAAGTGAAAACGGAAGGTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 123} {0: 1, 1: 0, 2: 1, 3: 11, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!