ID: 1090640686_1090640697

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1090640686 1090640697
Species Human (GRCh38) Human (GRCh38)
Location 11:128726554-128726576 11:128726605-128726627
Sequence CCGCCTAAGCTCCATACCAATGG AGTCACTTGGCTAGATAGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 60} {0: 1, 1: 0, 2: 0, 3: 15, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!