ID: 1090720525_1090720527

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1090720525 1090720527
Species Human (GRCh38) Human (GRCh38)
Location 11:129468072-129468094 11:129468101-129468123
Sequence CCATGAACATGAGAAAAAGGAGC AGGCTGAAAATTCCAAAAACCGG
Strand - +
Off-target summary No data {0: 25, 1: 31, 2: 32, 3: 62, 4: 432}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!