ID: 1090780379_1090780385

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1090780379 1090780385
Species Human (GRCh38) Human (GRCh38)
Location 11:130002187-130002209 11:130002208-130002230
Sequence CCTGCCCGCCGCGCCCGGAGCGC GCCCGCGCAACCGCCGCCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 74, 4: 474} {0: 1, 1: 1, 2: 0, 3: 34, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!