ID: 1090882923_1090882927

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1090882923 1090882927
Species Human (GRCh38) Human (GRCh38)
Location 11:130850041-130850063 11:130850060-130850082
Sequence CCCCCACAAATTCATGTGTTGAA TGAACTCCTAACTTCCAATGTGG
Strand - +
Off-target summary {0: 3, 1: 40, 2: 326, 3: 1321, 4: 2768} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!