ID: 1090899705_1090899709 |
View in Genome Browser |
Spacer: 2 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1090899705 | 1090899709 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 11:131017662-131017684 | 11:131017687-131017709 |
| Sequence | CCTTCCCTGCTTTAAATCCTAGT | TTACTAATAAATGTCCTTTGTGG |
| Strand | - | + |
| Off-target summary | No data | {0: 35, 1: 72, 2: 70, 3: 88, 4: 316} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||