ID: 1091021229_1091021237

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1091021229 1091021237
Species Human (GRCh38) Human (GRCh38)
Location 11:132101971-132101993 11:132101988-132102010
Sequence CCCATTTCCCACCATTCCTACAG CTACAGGTCACACTGCTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 229} {0: 1, 1: 0, 2: 3, 3: 13, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!