ID: 1091041722_1091041732

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1091041722 1091041732
Species Human (GRCh38) Human (GRCh38)
Location 11:132287133-132287155 11:132287175-132287197
Sequence CCTTGTCAGATCTGTCTAACCAG AGGCCAGTTTCAGTCCTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 108} {0: 1, 1: 0, 2: 0, 3: 11, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!