ID: 1091194485_1091194489

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1091194485 1091194489
Species Human (GRCh38) Human (GRCh38)
Location 11:133719684-133719706 11:133719727-133719749
Sequence CCTCGTTCTGGTCACGGTGCATC GACCTGATGCTCCTGCTCACAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!