ID: 1091217875_1091217885

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1091217875 1091217885
Species Human (GRCh38) Human (GRCh38)
Location 11:133914586-133914608 11:133914639-133914661
Sequence CCAAGCTCCAGCCCTTCCGGGAC CAGCACCGAAGCATAGCCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 255} {0: 1, 1: 0, 2: 0, 3: 5, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!